CSE1007: Java. Winter Semester 2018-19 lab problems.

-------------------------------------------

So, i used to run this blog back in 2nd semester, for skillrack problems for the OOPS with C++ course, now in the 6th semester i find that a lot of us have been coerced into taking the java course and the lab problems being given by professors are to a significant degree the same for all classes...

   ...So instead of sending my files to friends individually i've decided to dig up this forgotten grave of a blog and make one last post that i will keep updating over this semester as i do my lab tasks. 

    I will be following the cycle sheet that is being followed in my class and i'm told in some other classes too, and some professors that are not following it also happen to have coinciding questions so you will probably find some of your assignments here if not all. if however there is a popular question in other classes not being given in my class, DM me or drop in in the comments and i'll try to do that as well. 

Tl;dr = will post my java codes here; you may find most or some of what you need; dm/comment for requests; jet fuel can't melt steel beams; i used lower case i for the pronoun and this font which makes me artsy af (thats how it works just ask rupi kaur). 

-----------------------------------------

Nuff said..

 

----Question 1----

Write a program to read the First name and Last name of a person, his weight and height using command line arguments. Calculate the BMI Index which is defined as the individual's body mass divided by the square of their height.

Category	BMI Range-Kg/m2
Underweight	<18.5
Normal (healthy weight)	18.5 to 25
Overweight	25 to 30
Obese Class	Over 30

Display the name and display his category based on the BMI value thus calculated.

Code: 

import java.io.*;
import java.util.Scanner;
class ct0{
    public static void main(String[] args){
        float bmi=Float.parseFloat(args[1])/Float.parseFloat(args[2])/Float.parseFloat(args[2]);
         String c;
        if (bmi<18.5) 
            c="Underweight";
        else if (bmi<25)
            c="Normal";
        else if (bmi<30)
            c="overweight";
        else
            c="obese";
        System.out.println(args[0]+" "+c);
    }
}

Output:

 

----Question 2----

If there are 4 batches in BTech(IT) learning ‘ITE2005’ course, read the count of the slow learners (who have scored <25) in each batch. Tutors should be assigned in the ratio of 1:4 (For every 4 slow learners, there should be one tutor). Determine the number of tutors for each batch. Create a 2-D jagged array with 4 rows to store the count of slow learners in the 4 batches. The number of columns in each row should be equal to the number of groups formed for that particular batch ( Eg., If there are 23 slow learners in a batch, then there should be 6 tutors and in the jagged array, the corresponding row should store 4, 4, 4, 4, 4,3). Use for-each loop to traverse the array and print the details. Also print the number of batches in which all tutors have exactly 4 students.

Code:

import java.io.*;
import java.util.Scanner;

class ct1{
    public static void main(String[] args){
        System.out.println(Integer.parseInt("10")+Integer.valueOf("10a"));
        Scanner in=new Scanner(System.in);
        int i,n,x,j;
        int[][] ja=new int[4][];
         for( i=0;i<4; i++){
            System.out.println("input number of students in batch"+(i+1));
            x=in.nextInt();
            n=(x/4)+((x/4)*4==x?0:1);
            ja[i]=new int[n];
            for(j=0;j<n;j++,x-=4) ja[i][j]=x>4?4:x;
        }
        System.out.println("array made, now we parse:");
        int tot=0;
        for( i=0;i<4; i++){
            System.out.println("");
            System.out.println("batch "+(i+1));
            for(j=0;j<ja[i].length;j++){
                System.out.print(ja[i][j]+", ");
                if(ja[i][j]==4) tot++;
            }
        }
        System.out.println("total number of full groups is:"+tot);
    }
}

Output:

----Question 3----

Write a program to read a chemical equation and find out the count of the reactants and the products. Also display the count of the number of molecules of each reactant and product.

Eg., For the equation, 2NaOH + H2SO4 -> Na2SO4+ 2H2O, the O/P should be as follows.

Reactants are 2 moles of NaOH, 1 mole of H2SO4.

Products are 1 mole of Na2SO4 and 2 moles of H2O.

Code:

import java.io.*;
import java.util.Scanner;

class ct2{

    public static void main(String[] args){

        Scanner in=new Scanner(System.in);

        String e=in.nextLine();

        int i;

        System.out.print("Reactants are:");

        for(String p : e.split("-")[0].split(" ")){

            if(p.charAt(0)>='A' && p.charAt(0)<='Z') System.out.print("1 mole of "+p);

            else if(p.charAt(0)>='0' && p.charAt(0)<='9'){

                for(i=0;i<p.length() && p.charAt(i)>='0' && p.charAt(i)<='9';i++);

                System.out.print(p.substring(0,i));

                System.out.print(" mole of "+p.substring(i)+", ");

            }

        }

        System.out.print("\n Products are:");

        for(String p : e.split("-")[1].split(" ")){

            if(p.charAt(0)>='A' && p.charAt(0)<='Z') System.out.print("1 mole of "+p);

            else if(p.charAt(0)>='0' && p.charAt(0)<='9'){

                for(i=0;i<p.length() && p.charAt(i)>='0' && p.charAt(i)<='9';i++);

                System.out.print(p.substring(0,i));

                System.out.print(" mole of "+p.substring(i)+", ");

            }

        }

        System.out.print("\n");

    }

}

Output:

----Question 4----

(Bioinformatics: finding genes) Biologists use a sequence of letters A, C, T, and G to model a genome. A gene is a substring of a genome that starts after a triplet ATG and ends before a triplet TAG, TAA, or TGA. Furthermore, the length of a gene string is a multiple of 3 and the gene does not contain any of the triplets ATG, TAG, TAA, and TGA. Write a program that prompts the user to enter a genome and displays all genes in the genome. If no gene is found in the input sequence, displays no gene. Here are the sample runs:

Enter a genome string: TTATGTTTTAAGGATGGGGCGTTAGTT

O/P: TTT

GGGCGT

Code:

import java.io.*;
import java.util.Scanner;
class ct3{
    public static void main(String[] args){
        Scanner in=new Scanner(System.in);
        String e=in.nextLine(), g="",a="",b="",c="";
        int i;
        boolean x = false;
        for(String p : e.split("ATG")){
            i=p.length();
            a=p.split("TAG")[0];
            b=p.split("TAA")[0];
            c=p.split("TGA")[0];
            if(a.length()!=p.length() && a.length()%3==0) {i=a.length(); g=a;}
            if(b.length()!=p.length() && b.length()%3==0 && b.length()<i) {i=b.length(); g=b;}
            if(c.length()!=p.length() && c.length()%3==0 && c.length()<i) {i=c.length(); g=c;}

            if (i<p.length()) System.out.println(g);    

        }

    }

}

Output:

----Question 5----

1. Write a program to demonstrate the knowledge of students in working with classes and objects.

Eg.,Create a class Film with string objects which stores name, language and lead_actor and category (action/drama/fiction/comedy). Also include an integer data member that stores the duration of the film. Include parameterized constructor, default constructor and accessory functions to film class. Flim objects can be initialized either using a constructor or accessor functions. Create a class FilmMain that includes a main function. In the main function create a vector object that stores the information about the film as objects. Use the suitable methods of vector class to iterate the vector object to display the following

1. The English film(s) that has Arnold as its lead actor and that runs for shortest duration.
2. The Tamil film(s) with Rajini as lead actor.
3. All the comedy movies.

   Code: 

   import java.io.*;

   import java.util.Scanner;

   import java.util.Vector;

   import java.util.Iterator;

   class Film{

       public String name, lang, lead_actor, category;

       public int dur;

       public Film(){

           name="";

           lang="";

           lead_actor="";

           category="";

           dur=0;

       }

       public Film(String a,String b,String c,String d, int e){

           this.set(a,b,c,d,e);

       }

       public void set(String a,String b,String c,String d, int e){

           name=a;

           lang=b;

           lead_actor=c;

           category=d;

           dur=e;

       }

       public void prnt(){

           System.out.println(name+", "+lang+", "+lead_actor+", "+category+", "+dur);

       }

   }

   public class FilmMain{

       public static void main(String[] args){

           Scanner in=new Scanner(System.in);

           Vector<Film> v = new Vector<Film>();

           v.add(new Film("Terminator","English","Arnold","action",123));

           v.add(new Film("Apdi123","Tamil","Rajini","comedy",123));

           v.add(new Film("Terminator:outtakes","English","Arnold","comedy",11));

           Iterator<Film> it1=v.iterator();

           Iterator<Film> it2=v.iterator();

           Iterator<Film> it3=v.iterator();

           System.out.println("\n\na. The English film(s) that has Arnold as its lead actor and that runs for shortest duration.=");

           int s=999;

           Film y=new Film();

           while(it1.hasNext()){

               Film x=it1.next();

               if (x.lead_actor.equalsIgnoreCase("arnold") && x.dur<s){

                   s=x.dur;

                   y=x;

               }

           }

           y.prnt();

           System.out.println("\n\nb. The Tamil film(s) with Rajini as lead actor.=");

           while(it2.hasNext()){

               Film x=it2.next();

               if (x.lead_actor.equalsIgnoreCase("rajini")) x.prnt();

           }

   
   

           System.out.println("\n\nc. All the comedy movies.=");

           while(it3.hasNext()){

               Film x=it3.next();

               if (x.category.equalsIgnoreCase("comedy")) x.prnt();

           }

       }

   }

    

   
   

   Output:

    

    

   ----Question 6----

    

   Define an abstract class ‘Themepark’ and inherit 2 classes ‘Queensland’ and ‘Wonderla’ from the abstract class. In both the theme parks, the entrance fee for adults is Rs. 500 and for children it is Rs. 300. If a family buys ‘n’ adult tickets and ‘m’ children tickets, define a method in the abstract class to calculate the total cost. Also, declare an abstract method playGame() which must be redefined in the subclasses.
   In Queensland, there are a total of 30 games. Hence create a Boolean array named ‘Games’ of size 30 which initially stores false values for all the elements. If the player enters any game code that has already been played, a warning message should be displayed and the user should be asked for another choice. In Wonderla, there are a total of 40 different games. Thus create an integer array with 40 elements. Here, the games can be replayed, until the user wants to quit. Finally display the total count of games that were repeated and count of the games which were not played at all.

   Code:

   import java.io.*;

   import java.util.Scanner;

   import java.util.Vector;

   import java.util.Arrays;

   import java.util.Iterator;

   abstract class themepark{

       public int total_cost(int m,int n){

           return 500*n+300*m;

       }

       abstract void playGame();

   }

   class Queensland extends themepark{

       public void playGame(){

           Scanner in=new Scanner(System.in);

           boolean[] Games=new boolean[30];

           Arrays.fill(Games, false);

           boolean wtp=true;

           while(wtp){

               System.out.println("which game do you want to play? (1-30). 0 to quit");

               int x=in.nextInt();

               if(x==0) wtp=false;

               else if(x>30 || x<1) System.out.println("please input valid number");

               else if(Games[x]==true) System.out.println("Warning! play each game atmost once.");

               else{

                   System.out.println("Sucessfully played game "+x);

                   Games[x]=true;

               }

           }

       }

   }

   class Wonderla extends themepark{

       public void playGame(){

           Scanner in=new Scanner(System.in);

           int[] Games=new int[40];

           Arrays.fill(Games, 0);

           boolean wtp=true;

           while(wtp){

               System.out.println("which game do you want to play? (1-40). 0 to quit");

               int x=in.nextInt();

               if(x==0) wtp=false;

               else if(x>40 || x<1) System.out.println("please input valid number");

               else{

                   System.out.println("Sucessfully played game "+x);

                   Games[x]++;

               }

           }

           System.out.println("Games repeated=");

           for(int i=0;i<40;i++) if(Games[i]>1) System.out.print(i+", ");

           System.out.println("\nGames not played=");

           for(int i=0;i<40;i++) if(Games[i]==0) System.out.print(i+", ");

           System.out.println("\nGames played once=");

           for(int i=0;i<40;i++) if(Games[i]==1) System.out.print(i+", ");

       }

   }

   public class thmprk{

   
   

       public static void main(String[] args) {

           System.out.println("\n\nQueensland:");

           new Queensland().playGame();

           System.out.println("\n\nWonderla:");

           new Wonderla().playGame();

       }

   }

    

   Output:

   

    

    

    

   ----Question 8----

    

   1. Write a program to demonstrate the knowledge of students in working with user-defined packages and sub-packages.
   Eg., Within the package named ‘primespackage’, define a class Primes which includes a method checkForPrime() for checking if the given number is prime or not. Define another class named TwinPrimes outside of this package which will display all the pairs of prime numbers whose difference is 2. (Eg, within the range 1 to 10, all possible twin prime numbers are (3,5), (5,7)). The TwinPrimes class should make use of the checkForPrime() method in the Primes class.

    

   Code: 

    

    File= Primes.java

   
   
   package primespackage;

   public class Primes{

       public static boolean checkForPrime(int a){

           if(a<4) return a>1;

           for(int i=2;i<a/2;i++) if (a%i==0) return false;

           return true;

           //not optimal algorithm for primality test, trivial;

           //you can improve complexity if you want,

           //your VIT professor won't care much for it though...

       }

   }

    File= TwinPrimes.java

   
   
   import java.util.*;

   import java.io.*;

   import primespackage.Primes;

   class TwinPrimes{

           public static void main(String[] args){

           Scanner in=new Scanner(System.in);

           System.out.println("input limit to check for twin primes till:");

           int n=in.nextInt();

           if (n<5) return;

           for(int i=3;i+1<n;i+=4){

               if(Primes.checkForPrime(i)&&Primes.checkForPrime(i+2)) System.out.println(i+", "+(i+2));

               if(i+2<n&&Primes.checkForPrime(i+1)&&Primes.checkForPrime(i+3)) System.out.println((i+1)+", "+(i+3));

           }

       }

   }

   Terminal Output: 

   Do exactly this when you've 'cd'd into in the directory you saved these two files in.

   rohan@AE86:~/src/java$ javac -d . Primes.java
   rohan@AE86:~/src/java$ javac  TwinPrimes.java
   rohan@AE86:~/src/java$ java TwinPrimes
   input limit to check for twin primes till:
   500
   3, 5
   11, 13
   59, 61
   71, 73
   107, 109
   179, 181
   191, 193
   227, 229
   239, 241
   311, 313
   347, 349
   419, 421
   431, 433
   rohan@AE86:~/src/java$